View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1719_low_3 (Length: 428)
Name: NF1719_low_3
Description: NF1719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1719_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 2 - 408
Target Start/End: Complemental strand, 11869239 - 11868815
Alignment:
| Q |
2 |
aaatcaaattttcacaacaccacaaaatgagaatcccgaaaaaactaataaaacc-----------------taatatgagcagccggaatggaaactac |
84 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||| ||||||||||||||| | ||||| ||||||||||||||||||| || |
|
|
| T |
11869239 |
aaatcaaattttcacaacaccacaaaattagaaaccctaaaaaactaataaaaacctgctgagtggtgcctttaataggagcagccggaatggaaacaac |
11869140 |
T |
|
| Q |
85 |
gccatgaacgtccaccacagactcgcggctgagagcttttgtgaacttcaccatctgctcactcactgaatcaggctgagtttgcaccaagcactgtaca |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11869139 |
gccatgaacgtccaccacagactcgcggctgatagtttttgcgaacttcaccatctgctcactcactgaatcaggctgagtttgcaccaagcactgtaca |
11869040 |
T |
|
| Q |
185 |
gtttcaacattttctctgaggactaaaaacgccatcttcttactcactggtcgtat-gtttgtaccctcccttgaattctaactgaattattcaccggtg |
283 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| ||| |
|
|
| T |
11869039 |
gtttcaacattttctttgaggactaaaaacgccaacttcttactcactggtcgtatagtttgtaccctccctcaaattctaactgaattattcaccagtg |
11868940 |
T |
|
| Q |
284 |
aatcgtcaagtgctttgacctgggtccgggggacaggatggaccggtgtcttcgattgcagctcctttaacgggatgtcgccataattggtggctaaggg |
383 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11868939 |
aatcgtcaagtgcttcgacctgggtccgggggacaggatggaccggtgtcttcgattgcagctcctttaacgggatgtcgccataattggtggctaaggg |
11868840 |
T |
|
| Q |
384 |
gtctgctgagagattagagacggac |
408 |
Q |
| |
|
||||||||||||||||||| ||||| |
|
|
| T |
11868839 |
gtctgctgagagattagaggcggac |
11868815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 131 - 225
Target Start/End: Complemental strand, 3103655 - 3103561
Alignment:
| Q |
131 |
ttcaccatctgctcactcactgaatcaggctgagtttgcaccaagcactgtacagtttcaacattttctctgaggactaaaaacgccatcttctt |
225 |
Q |
| |
|
|||||||||||| ||| ||| ||||||| || | || |||||||||||||| || | |||||||||||| |||||| |||||||||||||| |
|
|
| T |
3103655 |
ttcaccatctgcggacttactaaatcaggttgtgcctgaaccaagcactgtacggtgaaaccattttctctgatgactaagaacgccatcttctt |
3103561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University