View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1719_low_6 (Length: 250)
Name: NF1719_low_6
Description: NF1719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1719_low_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 9 - 236
Target Start/End: Original strand, 34432237 - 34432467
Alignment:
| Q |
9 |
cttatagaggagaatttttaaaatacaaaaacacgtgtcattaatcatttttactgctttgttaacnnnnnnn---tggtactactgttaaacacttttg |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34432237 |
cttatagaggagaatttttaaaatacaaaaacacgtgtcattaatcatttttactgctttgttaacaaaaaaaaaatggtactactgttaaacacttttg |
34432336 |
T |
|
| Q |
106 |
gaatctatgtattgtaatattttccacnnnnnnntgtattgtaattttgaaaatgttttgcatttttggttaataaaataattaaagtggttaatgaaat |
205 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34432337 |
gaatctatgtattgtaatattttcctcaaaaaaatgtattgtaattttgaaaatgttttgcatttttggttaataaaataattaaagtggttaatgaaat |
34432436 |
T |
|
| Q |
206 |
ttatattttaaaagtagtaaacaaggtatat |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
34432437 |
ttatattttaaaagtagtaaacaaggtatat |
34432467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University