View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1719_low_7 (Length: 244)
Name: NF1719_low_7
Description: NF1719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1719_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 112
Target Start/End: Original strand, 52444323 - 52444436
Alignment:
| Q |
1 |
gtatcgtcttcaactattactcgcctgcttcaagcgattaacgttaaggaagaaattatatgtctccattgtaggttcatcaggagaaact--atatatg |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
52444323 |
gtatcgtcttcaactattactcgcctgcttcaagcgattaacgttaaggaataaattatatgtctccattgtaggttcatcaggagaaactacatatatg |
52444422 |
T |
|
| Q |
99 |
atcactattatttg |
112 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
52444423 |
atcactatcatttg |
52444436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 140 - 214
Target Start/End: Original strand, 52444431 - 52444505
Alignment:
| Q |
140 |
catttgttaaatttacaccatttaaattcgcatgttattttaaaaatacatattatttagtggaaatgaatcatt |
214 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
52444431 |
catttgttaaatttacaccatttgaatttgcatgttattttaaaaatacatattatttagtggaaatgtatcatt |
52444505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University