View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1720-Insertion-11 (Length: 74)
Name: NF1720-Insertion-11
Description: NF1720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1720-Insertion-11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 41; Significance: 0.000000000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.000000000000006
Query Start/End: Original strand, 8 - 48
Target Start/End: Complemental strand, 5525489 - 5525449
Alignment:
| Q |
8 |
atataaacaacagcagcacaaataccgtgtatagatctttc |
48 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5525489 |
atataaacaacagcagcacaaataccgtgtatagatctttc |
5525449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University