View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17200_high_5 (Length: 244)
Name: NF17200_high_5
Description: NF17200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17200_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 156 - 218
Target Start/End: Complemental strand, 9026054 - 9025992
Alignment:
| Q |
156 |
gagattaatttaaagtggagtcattatttattcttgtcgtttgatttgataaatatggttact |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9026054 |
gagattaatttaaagtggagtcattatttattcttgtcgtttgatttgataaatatggttact |
9025992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 9026123 - 9026063
Alignment:
| Q |
18 |
atgaagtgtgaaaaagaaaaacaagggtttgagttatgttcccttgcaaaagaaatggaaa |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9026123 |
atgaagtgtgaaaaagaaaaacaagggtttgagttatgttcccttggaaaagaaatggaaa |
9026063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University