View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17201_high_12 (Length: 241)
Name: NF17201_high_12
Description: NF17201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17201_high_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 27807688 - 27807904
Alignment:
| Q |
1 |
ctgtttgagacctattatgttgatatgttatgtttgttggagaattagtcccagttatagtacatagtcctagagcctgcgctggaggggtggaactgtg |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
27807688 |
ctgtttgtgacctattatgttgatatgttatgtt-gttggagaataagtcccagttatagtacatagtcctagagcctgcactggaggggtggaactgtg |
27807786 |
T |
 |
| Q |
101 |
ccattaatgctcacttgacatgtgttcgttttattctagtctagactccttcaatttgtgtcggtttttctgctatcgatgttggtgatgatttgcaacg |
200 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27807787 |
ccattactgctcactttgattgtgttcgttttattctagtctagactc---caatttgtgtcggtttttctgctatcgatgttggtgatgatttgcaacg |
27807883 |
T |
 |
| Q |
201 |
agtattgtgtaagtggttagt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
27807884 |
agtattgtgtaagtggttagt |
27807904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 83 - 221
Target Start/End: Complemental strand, 45639027 - 45638889
Alignment:
| Q |
83 |
tggaggggtggaactgtgccattaatgctcacttgacatgtgttcgttttattctagtctagactccttcaatttgtgtcggtttttctgctatcgatgt |
182 |
Q |
| |
|
||||||||||||||||| ||| || ||||||||| |||||||||||||||||| |||||| |||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
45639027 |
tggaggggtggaactgtaccaatactgctcactttggatgtgttcgttttattctggtctaggctccttcaatttgtgttggtttttctgctatcaatgt |
45638928 |
T |
 |
| Q |
183 |
tggtgatgatttgcaacgagtattgtgtaagtggttagt |
221 |
Q |
| |
|
| ||| | |||||||| |||||| || ||||||||||| |
|
|
| T |
45638927 |
ttgtggttatttgcaaagagtatcatgcaagtggttagt |
45638889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University