View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17201_high_16 (Length: 224)
Name: NF17201_high_16
Description: NF17201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17201_high_16 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 12 - 224
Target Start/End: Complemental strand, 35080247 - 35080035
Alignment:
| Q |
12 |
tattctcacgaggataattgaagatcacgtttatagatcttatacataagaaattcatcaatcggagtatatgtatatataggaaatgacaaccattaat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35080247 |
tattctcacgaggataattgaagatcacgtttatagatcttatacataagaaattcatcaatcggagtatatgtatatataggaaatgacaaccattaat |
35080148 |
T |
 |
| Q |
112 |
atctcgtgatttgtgaaaattgaatgaaatggcaattttttgaaaaatacagcatatcaatactggtgtgaattgagtcgggtcaacaaaaaagaacaaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35080147 |
atctcgtgatttgtgaaaattgaatgaaatggcaattttttgaaaaatacagcatatcaatactggtgtgaattgagtcgggtcaacaaaaaagaacaaa |
35080048 |
T |
 |
| Q |
212 |
gagtattaatggc |
224 |
Q |
| |
|
||||||||||||| |
|
|
| T |
35080047 |
gagtattaatggc |
35080035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University