View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17201_low_15 (Length: 224)

Name: NF17201_low_15
Description: NF17201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17201_low_15
NF17201_low_15
[»] chr2 (1 HSPs)
chr2 (17-196)||(29473483-29473662)


Alignment Details
Target: chr2 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 17 - 196
Target Start/End: Complemental strand, 29473662 - 29473483
Alignment:
17 acaatgaatacacaacagatagataaataagagagagaaagtaaagctataaactttgattgatgagagcatgaaaaagtttagataaaccgtgaaatat 116  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
29473662 acaatgaatacacaacagagagataaataagagagagaaagtaaagctataaactttgattgatgagagcatgaaaaagtttggataaaccgtgaaatat 29473563  T
117 atgatcatgattattgagtcaactccatattgtgttacactactttacagcaaagtagcataaacaaactagttactatt 196  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29473562 atgatcatgattattgagtcaactccatattgtgttacactactttacagcaaagtagcataaacaaactagttactatt 29473483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University