View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17202_high_28 (Length: 311)
Name: NF17202_high_28
Description: NF17202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17202_high_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 63 - 293
Target Start/End: Original strand, 6002628 - 6002858
Alignment:
| Q |
63 |
tcgtgggttattcgtgaacttggctccgctgtatatagcaaagctcttttgtttttcatattttctttcctcaatgtctttgtattctttcgtgcacaac |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6002628 |
tcgtgggttattcgtgaacttggctccgctgtatatagcaaagctcttttgtttttcatattttctttcctcaatgtctttgtattctttcgtgcacaac |
6002727 |
T |
 |
| Q |
163 |
aagtatcccttgagtaaccaatagcattgacacagg-nnnnnnnngtgagtctttcatattgtatatccttattaaaagcatagccatctcgttcaacaa |
261 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6002728 |
aagtatcccttgagtaaccaatagca-tgacacaggaaaaaaaaagtgagtctttcatattgtatatccttattaaaagcatagccatctcgttcaacaa |
6002826 |
T |
 |
| Q |
262 |
gaaggaattcttgcagatcaagatccactcag |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
6002827 |
gaaggaattcttgcagatcaagatccactcag |
6002858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 6002589 - 6002522
Alignment:
| Q |
1 |
catgggttgtgggcaaaatacatgggtgtgtgaataataatttggcttgcatgcagtacgcctcgtgg |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6002589 |
catgggttgtgggcaaaatacatgggtgtgtgaataataatttggcttgcatgcagtacgcctcgtgg |
6002522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 52; Significance: 8e-21; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 32188357 - 32188290
Alignment:
| Q |
1 |
catgggttgtgggcaaaatacatgggtgtgtgaataataatttggcttgcatgcagtacgcctcgtgg |
68 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
32188357 |
catgggtggtaggcaaaatacatgggtgtgtgaataataatttggcttgcatgcagtatgcgtcgtgg |
32188290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 118 - 189
Target Start/End: Original strand, 31034300 - 31034371
Alignment:
| Q |
118 |
tcatattttctttcctcaatgtctttgtattctttcgtgcacaacaagtatcccttgagtaaccaatagcat |
189 |
Q |
| |
|
|||||||||||||||| || ||||||||||||| |||||| ||| |||||||||||| | ||||||||| |
|
|
| T |
31034300 |
tcatattttctttccttggtgcctttgtattcttttgtgcacgacagttatcccttgagtgatcaatagcat |
31034371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University