View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17202_low_18 (Length: 397)
Name: NF17202_low_18
Description: NF17202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17202_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 18 - 387
Target Start/End: Complemental strand, 46550210 - 46549855
Alignment:
| Q |
18 |
gtttttggttcttatttgtatgcatgcatgcatgcatatccaatagaaaaatacgtgtcttgttttaataccctttatttatggctttatgattgcacaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| ||||||||||||||||| | |
|
|
| T |
46550210 |
gtttttggttcttatttgtatgcatgcatgcat----atccaatagaaaaa-acgtgtcttgttttaatac----------tggctttatgattgcacca |
46550126 |
T |
 |
| Q |
118 |
cgacgatggcagcttttgcagaatatatgaatgttttt-attgtgaaagcttgctgacttggtcaaaattaggtcaagtttaggagtattaattatgtat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46550125 |
cgacgatggcagcttttgcagaatatatgaatgttttttattgtgaaagcttgctgacttggtcaaaattaggtcaagtttaggagtattaattatgtat |
46550026 |
T |
 |
| Q |
217 |
tgtcattgaatggnnnnnnnnatgattcgattcaaaactacgtcctgcttaactaaaagtcaaataccgagaacagcaattcatgcaaatttgaggcatg |
316 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
46550025 |
tgtcattgaatggttttttttatgattcgattcaaaactacgtcctgcttaactaaaagtcaaataccgagaacagcaattcatgcaaatatgaggcatg |
46549926 |
T |
 |
| Q |
317 |
aatattcaccaccctccatagcaaaatatttattacctacttgctgtaacacataaacttcatcccctatg |
387 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||||| |||| |
|
|
| T |
46549925 |
aatatttaccacccaccatagcaaaatatttattacctacttgctgtaacacctaaacatcatcccttatg |
46549855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University