View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17202_low_21 (Length: 361)
Name: NF17202_low_21
Description: NF17202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17202_low_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 133; Significance: 4e-69; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 182 - 346
Target Start/End: Complemental strand, 37574391 - 37574227
Alignment:
| Q |
182 |
ctatatattttgtttgtttgacgcaatatatactattatttcttgatttctccgatatgtatgtggtgtgcggtttggttcggttctaaaaaagaaattt |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| ||| | |
|
|
| T |
37574391 |
ctatatattttgtttgtttgacgcaatatatactattatttcttgatttctccgatatgtatgtggtgcgcggtttggttcagttctaaaaaaaaaaact |
37574292 |
T |
|
| Q |
282 |
ataattcaacctaactcgagcgattgatataaaactacattcaaatacatataatatatttcgat |
346 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
37574291 |
ataattcaacctaactcgagcgattgatacaaaactacattcaaatacatccaatatatttcgat |
37574227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 1 - 115
Target Start/End: Complemental strand, 37574582 - 37574464
Alignment:
| Q |
1 |
cctcatcctcatgcatcatcagattaatc----tagctacccctacgtgtgaagagtgcgatgctaatacacgcgctcactcaattcatgtgtttgttca |
96 |
Q |
| |
|
||||||||||||||||||||| ||| ||| ||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37574582 |
cctcatcctcatgcatcatcaaattcatcactctagctacccctacgtgtgaagagcgcaatgctaatacacgcgctcactcaattcatgtgtttgttca |
37574483 |
T |
|
| Q |
97 |
attcatatgtccacatgac |
115 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
37574482 |
attcatatgtccacatgac |
37574464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 42; Significance: 0.000000000000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 285 - 346
Target Start/End: Original strand, 32971611 - 32971672
Alignment:
| Q |
285 |
attcaacctaactcgagcgattgatataaaactacattcaaatacatataatatatttcgat |
346 |
Q |
| |
|
|||||| |||||||||||||| |||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
32971611 |
attcaatctaactcgagcgatggatagaaaactacattcaaaaacatctaatatatttcgat |
32971672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University