View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17202_low_33 (Length: 290)
Name: NF17202_low_33
Description: NF17202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17202_low_33 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 10 - 274
Target Start/End: Original strand, 36407680 - 36407945
Alignment:
| Q |
10 |
agatgaacgcgcgcaacattgccatggttttcgcaccaaacatgactcaggtctgttccaattaattttgattctcaagcgatttagggacatctgagca |
109 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36407680 |
agatgaacgcacgcaacattgccatggttttcgcaccaaacatgactcaggtctgttccaattaattttgattctcaagcgatttagggacatctgagca |
36407779 |
T |
|
| Q |
110 |
atccaattaaactttt-ttattttggctatgaagtattttctaaactattattagttcatggttattctgatagtacttttacctttaggttcaagttaa |
208 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36407780 |
atccaattaaactttttttattttggctatgaagtatttgctaaactattattagttcatggttattctgatagtacttttacctttaggttcaagttaa |
36407879 |
T |
|
| Q |
209 |
ttacagtatttggattttctgattgcagatggcagatccattcactgcattgatgtacgcagttca |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36407880 |
ttacagtatttggattttctgattgcagatggcagatccattcactgcattgatgtacgcagttca |
36407945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 10 - 57
Target Start/End: Original strand, 19177404 - 19177451
Alignment:
| Q |
10 |
agatgaacgcgcgcaacattgccatggttttcgcaccaaacatgactc |
57 |
Q |
| |
|
||||||| || |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
19177404 |
agatgaatgcacgcaacattgccatggtttttgcaccaaacatgactc |
19177451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 10 - 61
Target Start/End: Original strand, 27036294 - 27036343
Alignment:
| Q |
10 |
agatgaacgcgcgcaacattgccatggttttcgcaccaaacatgactcaggt |
61 |
Q |
| |
|
||||||| ||| ||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
27036294 |
agatgaatgcgtgcaacattgccatggtttt--caccaaacatgactcaggt |
27036343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 24 - 61
Target Start/End: Complemental strand, 39991096 - 39991059
Alignment:
| Q |
24 |
aacattgccatggttttcgcaccaaacatgactcaggt |
61 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
39991096 |
aacattgccatggtttttgctccaaacatgactcaggt |
39991059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 10 - 66
Target Start/End: Complemental strand, 9246994 - 9246938
Alignment:
| Q |
10 |
agatgaacgcgcgcaacattgccatggttttcgcaccaaacatgactcaggtctgtt |
66 |
Q |
| |
|
||||||| ||||||||| | || |||||||||||||| |||||||| ||||| |||| |
|
|
| T |
9246994 |
agatgaatgcgcgcaacgtagctatggttttcgcacccaacatgacacaggtttgtt |
9246938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 10 - 58
Target Start/End: Complemental strand, 42527747 - 42527699
Alignment:
| Q |
10 |
agatgaacgcgcgcaacattgccatggttttcgcaccaaacatgactca |
58 |
Q |
| |
|
|||||||||| || || ||||| |||||||| ||||||||||||||||| |
|
|
| T |
42527747 |
agatgaacgcacgtaatattgcaatggtttttgcaccaaacatgactca |
42527699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University