View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17202_low_39 (Length: 250)
Name: NF17202_low_39
Description: NF17202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17202_low_39 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 11 - 250
Target Start/End: Complemental strand, 8986075 - 8985830
Alignment:
| Q |
11 |
cacagattggactaaaccattatgttctagccaaaacaaaagttcatgtataatct-ggaatgcacataccgatcccaacttttttatcctctttggaaa |
109 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||| |||||||| ||||||||||| |||||||||||||||||||||||||| |||||||||||| ||| |
|
|
| T |
8986075 |
cacaaattgaactaaaccattatgttctagccaaagcaaaagtttatgtataatcttggaatgcacataccgatcccaactttgttatcctctttgaaaa |
8985976 |
T |
|
| Q |
110 |
aagatgcatctacattacatttaaatatcccttattgtggcttcaaccgttttgcccttccaacatgtattataggtgcattcactgaatt-----ccat |
204 |
Q |
| |
|
| ||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8985975 |
aggatgcatctacattacatttaaatatcatttgttgtggcttcaaccgttttgcccttccaacatgtattataggtgcattcactgaattgtgtaccat |
8985876 |
T |
|
| Q |
205 |
ttgagttgccaaccattggtcaagcatatgttttgctctgtccacc |
250 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8985875 |
ttgagttgccaaccactggtcaagcatatgttttgctctgtccacc |
8985830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University