View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17202_low_40 (Length: 250)

Name: NF17202_low_40
Description: NF17202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17202_low_40
NF17202_low_40
[»] chr3 (2 HSPs)
chr3 (1-148)||(52686448-52686587)
chr3 (202-246)||(52686350-52686394)


Alignment Details
Target: chr3 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 148
Target Start/End: Complemental strand, 52686587 - 52686448
Alignment:
1 cgatttctttataaaaattcacatatttaaagtaccattgaaaaacatatgctattatgtttaggtgcagaggtggatccagaaataattgtttggatgt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||        |||||||||||||||||||||||||    
52686587 cgatttctttataaaaattcacatatttaaagtaccattgaaaaacatattctattatgtttaggtg--------gatccagaaataattgtttggatgt 52686496  T
101 gcactataatgcatgcacacgatttatgttttaataagcattaagcac 148  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
52686495 gcactataatgcatgcacacgatttatgttttaataagcattaagcac 52686448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 202 - 246
Target Start/End: Complemental strand, 52686394 - 52686350
Alignment:
202 tctacacatttcaattgacttgaaagtttgatagtataatctacc 246  Q
    |||||||||||||||||||||||||||||||||||| ||| ||||    
52686394 tctacacatttcaattgacttgaaagtttgatagtaaaatttacc 52686350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University