View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17202_low_40 (Length: 250)
Name: NF17202_low_40
Description: NF17202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17202_low_40 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 148
Target Start/End: Complemental strand, 52686587 - 52686448
Alignment:
| Q |
1 |
cgatttctttataaaaattcacatatttaaagtaccattgaaaaacatatgctattatgtttaggtgcagaggtggatccagaaataattgtttggatgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
52686587 |
cgatttctttataaaaattcacatatttaaagtaccattgaaaaacatattctattatgtttaggtg--------gatccagaaataattgtttggatgt |
52686496 |
T |
 |
| Q |
101 |
gcactataatgcatgcacacgatttatgttttaataagcattaagcac |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52686495 |
gcactataatgcatgcacacgatttatgttttaataagcattaagcac |
52686448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 202 - 246
Target Start/End: Complemental strand, 52686394 - 52686350
Alignment:
| Q |
202 |
tctacacatttcaattgacttgaaagtttgatagtataatctacc |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
52686394 |
tctacacatttcaattgacttgaaagtttgatagtaaaatttacc |
52686350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University