View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17202_low_46 (Length: 239)
Name: NF17202_low_46
Description: NF17202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17202_low_46 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 13 - 224
Target Start/End: Complemental strand, 35729673 - 35729462
Alignment:
| Q |
13 |
aatattcctataagaaatctccaatcaaatatgacattaagacttcacctaattatgcttgcttttcaacattatttgcaaaaacgtcaaacaatttaat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35729673 |
aatattcctataagaaatctccaatcaaatatgacattaagacttcacctaattatgcttgcttttcaacattatttgcaaaaacgtcaaacaatttaat |
35729574 |
T |
|
| Q |
113 |
tgaatagttcccctaagaattactctatctcttgttgctcagcatataggccacgactaatgagtctcccgtggcaggtctccaaccctaataaatgcac |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
35729573 |
tgaatagttcccctaagaattactctatctcttgttgctcaacatataggccacgattaatgagtcccccttggcaggtctccaaccctaataaatgcat |
35729474 |
T |
|
| Q |
213 |
tataagataact |
224 |
Q |
| |
|
|||||||||||| |
|
|
| T |
35729473 |
tataagataact |
35729462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 23 - 78
Target Start/End: Complemental strand, 35704542 - 35704487
Alignment:
| Q |
23 |
taagaaatctccaatcaaatatgacattaagacttcacctaattatgcttgctttt |
78 |
Q |
| |
|
||||||| ||||||| |||||||||| |||| ||||||||||||||| ||||||| |
|
|
| T |
35704542 |
taagaaaactccaattaaatatgacaataagcgttcacctaattatgcctgctttt |
35704487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University