View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17202_low_51 (Length: 221)
Name: NF17202_low_51
Description: NF17202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17202_low_51 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 8153099 - 8152977
Alignment:
| Q |
1 |
atatatgtttggttttggcaggaaatttaaccgggtgtaaaaaagg-----------aaaggaaaatagataaaagttttgataagttagatagcgggtc |
89 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||| |||| || |
|
|
| T |
8153099 |
atatatgtttggttttggtaggaaatttaaccgggtgtaaaaaagggaaggaaggggaaaggaaaatagataaaagtttagataagttagatcgcggatc |
8153000 |
T |
 |
| Q |
90 |
cgatcaatgttcataagacatac |
112 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
8152999 |
cgatcaatgttcataagatatac |
8152977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 116 - 212
Target Start/End: Complemental strand, 8152878 - 8152783
Alignment:
| Q |
116 |
gggcttattttgataattaagtgtagactctacataagtttcaactaatnnnnnnngtgaaagttagtctctaacatttctcttatctaagaataat |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8152878 |
gggcttattttgataattaagtgtagactctacatgagtttcaactaat-aaaaaagtgaaagttagtctctaacatttctcttatctaataataat |
8152783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University