View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17202_low_52 (Length: 215)
Name: NF17202_low_52
Description: NF17202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17202_low_52 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 53 - 145
Target Start/End: Complemental strand, 2167224 - 2167131
Alignment:
| Q |
53 |
tttatgcaaaattcagattttgatatttaatttgttgctcatc-ctcatggaagcaatgaaatgtttttgtgatgtcatttaatatatatcttt |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
2167224 |
tttatgcaaaattcagattttgatatttaatttgttgctcatcgatcatggaagcaatgaaatgtttttgtgatgtcatttaatctttatcttt |
2167131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University