View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17202_low_53 (Length: 215)
Name: NF17202_low_53
Description: NF17202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17202_low_53 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 15 - 200
Target Start/End: Complemental strand, 35729647 - 35729462
Alignment:
| Q |
15 |
aaatatgacattaagacttcacctaattatgcttgcttttcaacattatttgcaaaaacgtcaaacaatttaattgaatagttcccctaagaattactct |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35729647 |
aaatatgacattaagacttcacctaattatgcttgcttttcaacattatttgcaaaaacgtcaaacaatttaattgaatagttcccctaagaattactct |
35729548 |
T |
 |
| Q |
115 |
atctcttgttgctcagcatataggccacgactaatgagtctcccgtggcaggtctccaaccctaataaatgcactataagataact |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||| ||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
35729547 |
atctcttgttgctcaacatataggccacgattaatgagtcccccttggcaggtctccaaccctaataaatgcattataagataact |
35729462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University