View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17203_high_102 (Length: 242)
Name: NF17203_high_102
Description: NF17203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17203_high_102 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 228; Significance: 1e-126; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 39983745 - 39983514
Alignment:
| Q |
1 |
ttgctcctacctcataaggtaactataaatcatgtgttgcattcagttagcagggatgtgtttggatgacaaagagcctgaaggtttggaagcagatgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39983745 |
ttgctcctacctcataaggtaactataaatcatgtgttgcattcagttagcagggatgtgtttggatgacaaagagcctgaaggtttggaagcagatgat |
39983646 |
T |
|
| Q |
101 |
gagggaaatggaagatcccctacaaagctagcttctcacatgttttgcaaaacactcactgcctctgataccagcactcatggagggttttcggttccac |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39983645 |
gagggaaatggaagatcccctacaaagttagcttctcacatgttttgcaaaacactcactgcctctgataccagcactcatggagggttttcggttccac |
39983546 |
T |
|
| Q |
201 |
gtagagctgctgaagattgttttcctcctttg |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
39983545 |
gtagagctgctgaagattgttttcctcctttg |
39983514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 140 - 228
Target Start/End: Complemental strand, 4273553 - 4273465
Alignment:
| Q |
140 |
atgttttgcaaaacactcactgcctctgataccagcactcatggagggttttcggttccacgtagagctgctgaagattgttttcctcc |
228 |
Q |
| |
|
||||| ||||| || ||||| || ||||| || |||||||||||||| || || || || ||| ||||||||||||| || |||||||| |
|
|
| T |
4273553 |
atgttctgcaagactctcacagcttctgacactagcactcatggaggattctcagtgcctcgtcgagctgctgaagactgctttcctcc |
4273465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 135 - 232
Target Start/End: Original strand, 22235874 - 22235971
Alignment:
| Q |
135 |
ctcacatgttttgcaaaacactcactgcctctgataccagcactcatggagggttttcggttccacgtagagctgctgaagattgttttcctcctttg |
232 |
Q |
| |
|
|||||||||| ||||| ||||| |||| ||||||||||||||||||||| || || || || || ||||||||||||||||||||||||||||||||| |
|
|
| T |
22235874 |
ctcacatgttctgcaagacactaactgtctctgataccagcactcatggtggattctctgtgcctcgtagagctgctgaagattgttttcctcctttg |
22235971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 135 - 228
Target Start/End: Original strand, 34797620 - 34797713
Alignment:
| Q |
135 |
ctcacatgttttgcaaaacactcactgcctctgataccagcactcatggagggttttcggttccacgtagagctgctgaagattgttttcctcc |
228 |
Q |
| |
|
|||||||||| ||||| || || ||||| |||||||| ||||||||||| || || || || || ||| |||| || |||||||| |||||||| |
|
|
| T |
34797620 |
ctcacatgttctgcaagactcttactgcttctgatactagcactcatggtggattctctgtacctcgtcgagcagccgaagattgctttcctcc |
34797713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University