View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17203_high_103 (Length: 238)
Name: NF17203_high_103
Description: NF17203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17203_high_103 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 1 - 187
Target Start/End: Original strand, 36356543 - 36356730
Alignment:
| Q |
1 |
agtttctcgcgcactttacaacattttagatcatataatcctcataatatgaattagatgcggagggtggaaaaagaaattgtctaaa-ttaccgcaacg |
99 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
36356543 |
agtttctcgcgcactttacaacattttcgatcatataatcctcataatatgaattagatgtggagggtggaaaaagaaattgtctaaagttaccgcaacg |
36356642 |
T |
 |
| Q |
100 |
ctccactaattgggctctagagtaaaagtccaacatgatattagagccggatatgactcccaaaaagaaaacaaagtaagggagcttc |
187 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36356643 |
ctcaactaattgggctctagagtaaaagtccaacatgatattagagcccgatatgactcccaaaaagaaaacaaagtaagggagcttc |
36356730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University