View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17203_high_106 (Length: 236)

Name: NF17203_high_106
Description: NF17203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17203_high_106
NF17203_high_106
[»] chr7 (1 HSPs)
chr7 (1-170)||(48286251-48286420)


Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 170
Target Start/End: Complemental strand, 48286420 - 48286251
Alignment:
1 ataggcgacaataattacgtttcttgggttttggtcggaaagaaggtgggagagaagggtttcgtgttggaagcggtttttgttggatgtttgggtctct 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48286420 ataggcgacaataattacgtttcttgggttttggtcggaaagaaggtgggagagaagggtttcgtgttggaagcggtttttgttggatgtttgggtctct 48286321  T
101 ataacaaggtggttttggtagtattattggtttttgttcgggcgatggttgctgcattgtgattttgtgt 170  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48286320 ataacaaggtggttttggtagtattattggtttttgttcgggcgatggttgctgcattgtgattttgtgt 48286251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University