View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17203_high_110 (Length: 228)
Name: NF17203_high_110
Description: NF17203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17203_high_110 |
 | |
|
| [»] scaffold0173 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 77; Significance: 7e-36; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 2 - 86
Target Start/End: Original strand, 12049578 - 12049662
Alignment:
| Q |
2 |
tcaatatggagtattttcaaggttagtcgtgcaactcttgtaaatttaatttctgtaatcaccgcaacatctctctttattcatc |
86 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12049578 |
tcaatatgcagtcttttcaaggttagtcgtgcaactcttgtaaatttaatttctgtaatcaccgcaacatctctctttattcatc |
12049662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0173 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: scaffold0173
Description:
Target: scaffold0173; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 2 - 83
Target Start/End: Original strand, 31605 - 31686
Alignment:
| Q |
2 |
tcaatatggagtattttcaaggttagtcgtgcaactcttgtaaatttaatttctgtaatcaccgcaacatctctctttattc |
83 |
Q |
| |
|
|||||||| | |||| ||||||||||||||| |||||||||||||||||||||| || |||||||||||||||| ||||||| |
|
|
| T |
31605 |
tcaatatgcaatattctcaaggttagtcgtgtaactcttgtaaatttaatttctatattcaccgcaacatctctttttattc |
31686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University