View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17203_high_117 (Length: 219)
Name: NF17203_high_117
Description: NF17203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17203_high_117 |
 | |
|
| [»] scaffold0140 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0140 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 18 - 171
Target Start/End: Original strand, 32576 - 32730
Alignment:
| Q |
18 |
aacactaactacctaggtctatatacattactcatcaagccatatcttgaccgtacgtctttttcct-----atgaaatgaaatgaagaaatagacggaa |
112 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
32576 |
aacactaactacctaggtctatatacagtactcatcaagccatatattgaccgtacgtctttttcatatgaaatgaaatgaaatgaagaaatagacggaa |
32675 |
T |
|
| Q |
113 |
taaactcgaattaattcatatcaaagagaaattcattgaattaaaacatgaaaaaacgg |
171 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32676 |
taaactcg----aattcatatcaaagagaaattcattaaattaaaacatgaaaaaacgg |
32730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University