View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17203_high_59 (Length: 341)
Name: NF17203_high_59
Description: NF17203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17203_high_59 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 17 - 331
Target Start/End: Original strand, 26552698 - 26553021
Alignment:
| Q |
17 |
acctatgattacgatattacctatatatccggttaacataaggtgttatccagggctccattctgaaaatatgtatatcggtaaaatgcttgagaccttt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26552698 |
acctatgattacgatattacctatatatccggttaacataaggtgttatccagggctccattctgagaatatgtatatcggtaaaatgcttgagaccttt |
26552797 |
T |
 |
| Q |
117 |
tttaaagccatgctctatcagtgc---------ctctaactcgattactttcaaataagggcttttgtcaaggtctttgcaatacattacctgcatagcc |
207 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
26552798 |
tttaaagccatgctctatcagtgatgaatgtggctctaactcgattactttcaaataagggcttttgtcaaggtctttgcaatacattacctgcaaagcc |
26552897 |
T |
 |
| Q |
208 |
gtggtgcgcaacgtagactgttagtttagcatactcttttcnnnnnnnacaagttaaatttagtgtcgaggtgggttgaatttatgcgagtggtagatgc |
307 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26552898 |
gtggtgtgcaacgtggactgttagtttagcatactcttttctttttttacaagttaaatttagtgtcgaggtgggttgaatttatgcgagtggtagatgc |
26552997 |
T |
 |
| Q |
308 |
cagttggaattttatccgcctttg |
331 |
Q |
| |
|
|||||||||||||||||| ||||| |
|
|
| T |
26552998 |
cagttggaattttatccgtctttg |
26553021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University