View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17203_high_68 (Length: 305)
Name: NF17203_high_68
Description: NF17203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17203_high_68 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 1 - 289
Target Start/End: Original strand, 14285197 - 14285485
Alignment:
| Q |
1 |
acgatggtatatttctgcatataattgttgatactgtgaaccaatgaatgaacttttgctgcaatctgttcatacgatgatatattaactgcaagttgtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
14285197 |
acgatggtatatttctgcatataattgttgatactgtgaaccaatgaatgaacttttgctgcagtctgttcatacgatgatatattaactgcaagttgtt |
14285296 |
T |
 |
| Q |
101 |
agctaagcagcaaccaattgctttagtttagacacatgccacgtttccagtttgttgtgtctatggtcgatttgcattttcattctattggcacccttat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14285297 |
agctaagcagcaaccaattgctttagtttagacacatgccacgtttccagtttgttgtgtctatggtcgatttgcattttcattctattggcacccttat |
14285396 |
T |
 |
| Q |
201 |
atcacaaatcacgtcagtaacgaaaaattaatagctacgaagtatgtctattggagtattggtactcttgttaatttaattatggtgaa |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
14285397 |
atcacaaatcacgtcagtaacgaaaaattaatagctacaaagtatgtctattggagtattggtactcttgttgatttaattatggtgaa |
14285485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University