View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17203_high_79 (Length: 283)
Name: NF17203_high_79
Description: NF17203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17203_high_79 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 4e-78; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 118 - 265
Target Start/End: Original strand, 42651624 - 42651771
Alignment:
| Q |
118 |
gtactttatataattaatgtttgattttagttgttaaattatttgaattggtttcgtaggaaatactgtaatctgaaatgagtttgaatattcaaggact |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42651624 |
gtactttatataattaatgtttgattttagttgttaaattatttgaattggtttcgtaggaaatactgtaatctgaaatgagtttgaatattcaaggact |
42651723 |
T |
|
| Q |
218 |
gaattgtactactataagaaaataattaatgtttgatggtctaaaata |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42651724 |
gaattgtactactataagaaaataattaatgtttgatggtctaaaata |
42651771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 12 - 48
Target Start/End: Original strand, 42651515 - 42651551
Alignment:
| Q |
12 |
ttcatgctgtatgaatgttcaaaatggtaaacattac |
48 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42651515 |
ttcatgttgtatgaatgttcaaaatggtaaacattac |
42651551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University