View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17203_high_85 (Length: 259)
Name: NF17203_high_85
Description: NF17203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17203_high_85 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 16 - 182
Target Start/End: Complemental strand, 42003543 - 42003377
Alignment:
| Q |
16 |
attagtagagaccataacaatttatctagtttatgccaaaacaatcttgtctattttttactcttgnnnnnnnntaatgctaacaaatgttcttaaaaca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
42003543 |
attagtagagaccataacaatttatctagtttatgccaaaacaatcttgtcttttttttactcttgaaaaaaaataatgctaacaaatgttcttaaaaca |
42003444 |
T |
 |
| Q |
116 |
ctagttaagaaaacgtatataataatttattttgaaatttgtgcaaaaaatactcttttcaatgaaa |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42003443 |
ctagttaagaaaacgtatataataatttattttgaaatttgtgcacaaaatactcttttcaatgaaa |
42003377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University