View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17203_high_95 (Length: 251)
Name: NF17203_high_95
Description: NF17203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17203_high_95 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 37632147 - 37631915
Alignment:
| Q |
1 |
acaacaagttcatggtggagtacgacaacttgatggaagatgaagcaggtacaaagcatctcaaagaatcactcaagcttcaccagctccgaccagttct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37632147 |
acaacaagttcatggtggagtacgacaacttgatggaagatgaagcaggtacaaagcatctcaaagaatcactcaagcttcaccagctccgaccagttct |
37632048 |
T |
|
| Q |
101 |
tccgacggaggctaaccgggtgttcaaattcggcgatgaagttgatgcctatcacaatgatggatggtgggagggtcacattactgaggaattggaggat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37632047 |
tccgacggaggctaaccgggtgttcaaattcggcgatgaagttgatgcctatcacaatgatggatggtgggagggtcacattactgaggaattggaggat |
37631948 |
T |
|
| Q |
201 |
ggaaggttcgcggtgtatttcagagtttcgaag |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
37631947 |
ggaaggttcgcggtgtatttcagagtttcgaag |
37631915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University