View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17203_low_100 (Length: 253)
Name: NF17203_low_100
Description: NF17203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17203_low_100 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 2 - 244
Target Start/End: Complemental strand, 36356500 - 36356258
Alignment:
| Q |
2 |
catgaattatcacatgttggagtttaatatttgaacatcacttgtaggatgttgcttaacaatcacatgatttatttgcagcagttaatgtttatctgat |
101 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36356500 |
catgaattatcacacgttggagtttaatatttgaacatcacttgtatgattttgcttaacaatcacatgatttatttgcagcagttaatgtttatctgat |
36356401 |
T |
|
| Q |
102 |
ttgtgtgagtgcatgtgcaggctatacatgggcttggagcaagaaagttttctttagttggattaagccttctaggttgcgttccacatgaaatttctac |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36356400 |
ttgtgtgagtgcatgtgcaggctatacatgggcttggagcaagaaagttttctttagttggattaagccttctaggttgcgttccacatgaaatttctac |
36356301 |
T |
|
| Q |
202 |
ccatgggaaaaatgactcaagatgtattcaagaggagaataat |
244 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
36356300 |
ccatgggaaaaatgattcaaggtgtattcaagaggagaataat |
36356258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University