View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17203_low_115 (Length: 231)
Name: NF17203_low_115
Description: NF17203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17203_low_115 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 16 - 216
Target Start/End: Complemental strand, 54161638 - 54161435
Alignment:
| Q |
16 |
aacaagaaactaaataagtgaaagatgaatctgtatgattttggattgggaggaatgaaaatgaagaggttattaccgcaacagctttacaggcagcaca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54161638 |
aacaagaaactaaataagtgaaagatgaatctgtatgattttggattgggaggaatgaaaatgaagaggttattaccgcaacagctttacaggcagcaca |
54161539 |
T |
|
| Q |
116 |
tttgtcatcaacggcatgagacattccgatgagtaagaggaagatacagagatgaaacattgagatcttcatctcctatc---gacgcaataaggtttgt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
54161538 |
tttgtcatcaacggcatgagacattccgatgagtaagaggaagatacagagatgaaacattgagatcttcatctcctatcgacgacgcaataaggtttgt |
54161439 |
T |
|
| Q |
213 |
tctt |
216 |
Q |
| |
|
|||| |
|
|
| T |
54161438 |
tctt |
54161435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University