View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17203_low_119 (Length: 224)
Name: NF17203_low_119
Description: NF17203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17203_low_119 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 41584149 - 41584235
Alignment:
| Q |
1 |
acatgaatataataatttatgagatgaaatcgaaataatgattttggaattaaagcaaaagagaatccgtaaaacgaatcttcttac |
87 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41584149 |
acatgaatataataatttatgagaagaaatcgaaataatgattttggaattaaagcaaaagagaatccgtaaaacgaatcttcttac |
41584235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 149 - 208
Target Start/End: Original strand, 41584297 - 41584356
Alignment:
| Q |
149 |
cgccatatttatgtgaatcggaaagtttttcagatttgactcagtgagttaggatcgtgt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41584297 |
cgccatatttatgtgaatcggaaagtttttcagatttgactcagtgagttaggatcgtgt |
41584356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University