View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17203_low_122 (Length: 222)
Name: NF17203_low_122
Description: NF17203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17203_low_122 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 15 - 203
Target Start/End: Original strand, 50893790 - 50893978
Alignment:
| Q |
15 |
agaatatctgcctatttcactatttcttcttctttctttctgtttcgagaaaacggtaaacaagccacataaattgtgaatgtctactgtgccatcttga |
114 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
50893790 |
agaatatgtgcctatttcacgatttcttcttctttctttctgtttcgagaaaacggtaaacaagccacataaaatgtgaatgtctactgtgccatcttga |
50893889 |
T |
 |
| Q |
115 |
gttgtctcaatatttgaatagcacatttcagaataaccaaccacatttatacaaaaaataatcaatgatgaatatgcacacacatttac |
203 |
Q |
| |
|
| ||||||||||||||||||||||||||||||| ||||||| | |||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
50893890 |
gctgtctcaatatttgaatagcacatttcagaacaaccaacaagatttatacaaaaaataatcaatgacgaatatgcacacacatttac |
50893978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University