View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17203_low_54 (Length: 373)
Name: NF17203_low_54
Description: NF17203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17203_low_54 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 187 - 366
Target Start/End: Original strand, 46090558 - 46090737
Alignment:
| Q |
187 |
ccttatgtccctattggcttaatgattcaactcatttcccacaattgaagtgcttcttgaactactgcatattaaaaagtatgatgctactattgtgggt |
286 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46090558 |
ccttatgtccctattgacttaatgattcaactcatttcccacaattgaagtgcttcttgaactactgcatattaaaaagtatgatgctactattgtgggt |
46090657 |
T |
 |
| Q |
287 |
tgtatttgttaattccatcaccattgctctctcatagaaagagtctcagtctctttcgatcgacttatttgaacttatct |
366 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
46090658 |
tgtatttgttaattccatcaccattgctctctcatagaaagagtctcagtctctttcgattgacttatttgaacttatct |
46090737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 120; E-Value: 3e-61
Query Start/End: Original strand, 1 - 120
Target Start/End: Original strand, 46090372 - 46090491
Alignment:
| Q |
1 |
caatactttacagcttggtggtggggtgggtgatgaaaggtgtatatgtatagttttcttttcaatccttttgattagtgatatgaaatggatgttaatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46090372 |
caatactttacagcttggtggtggggtgggtgatgaaaggtgtatatgtatagttttcttttcaatccttttgattagtgatatgaaatggatgttaatg |
46090471 |
T |
 |
| Q |
101 |
caaatcatgattgtgttcac |
120 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
46090472 |
caaatcatgattgtgttcac |
46090491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University