View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17203_low_66 (Length: 330)
Name: NF17203_low_66
Description: NF17203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17203_low_66 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 64; Significance: 6e-28; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 35 - 134
Target Start/End: Original strand, 6009914 - 6010013
Alignment:
| Q |
35 |
tggaccacaatatttatatgaatatgtgaattggagtgaaggaccactagatgcaacctttaaaaaacttcattctaaacacataatcagggaccacaac |
134 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||| ||||| ||||||||||| || ||||| ||| |||||||||| ||| |||||||||| |
|
|
| T |
6009914 |
tggaccacaatatttatatgaatatgtcaattggagtgaaggaacactacatgcaaccttttaacaacttgattgtaaacacatagtcaaggaccacaac |
6010013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 149 - 227
Target Start/End: Original strand, 6010180 - 6010258
Alignment:
| Q |
149 |
ttattattctaatggttttatcatgtttaaataaaatgacacaataaactgaaatgcctcattataaatcaaattcaag |
227 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
6010180 |
ttattattctaatgacattatcatgttcaaataaaatgacacaataaactgatatgcctcattatgaatcaaattcaag |
6010258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 274 - 313
Target Start/End: Original strand, 6010276 - 6010315
Alignment:
| Q |
274 |
acattcagatttcacaaactgatgaattcaagctgtaact |
313 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6010276 |
acattcagagttcacaaactgatgaattcaagctgtaact |
6010315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University