View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17203_low_77 (Length: 298)
Name: NF17203_low_77
Description: NF17203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17203_low_77 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 16 - 287
Target Start/End: Complemental strand, 54161919 - 54161655
Alignment:
| Q |
16 |
atgaatctgaggataacggtgtaggtaggttaaattgtaaaatactac---ctgtaatcgattaactttccttgacgctggcccttggcatccaagcgat |
112 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
54161919 |
atgaatctcaggataaaggtgtaggtaggttaaattgtaaaatactactacctgtaatcgattaactttccttgacgctggcccttggcgtccaagcgat |
54161820 |
T |
 |
| Q |
113 |
ggcgcatatccaaatgattgcgaggcttctcctg--tttaaatacatattcaactattgaatgaatgatataaatatattacagacacagcaagctaatt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||| ||||||| ||||||||||| |||||||||||||| ||||||| |
|
|
| T |
54161819 |
ggcgcatatccaaatgattgcgaggcttctcctgtttttaaatacaaattcaacgattgaatgaat------------ttacagacacagcaggctaatt |
54161732 |
T |
 |
| Q |
211 |
gaatgaatgtaaaaaatgttacttacacgggcaagtccaatctctagctccccctgcaacacaacataggatcggat |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
54161731 |
gaatgaatgtaaaaaatgttacttacacgggcaagtccaatctctagctccccctgcaacaaaacataggatcggat |
54161655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University