View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17203_low_87 (Length: 277)
Name: NF17203_low_87
Description: NF17203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17203_low_87 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 5 - 260
Target Start/End: Complemental strand, 43186016 - 43185761
Alignment:
| Q |
5 |
aagcagcacagacacatataggagtataacacttttgtgctaatgtgagtaacttgatgattcagttggtaaagattcaacttagatcttataagaaatt |
104 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43186016 |
aagcaacacatacacatataggagtataacacttttgtgctaatgtgagtaacttgatgattcagttggtaaagattcaacttagatcttataagaaatt |
43185917 |
T |
 |
| Q |
105 |
ggatttcaatcccgcttctgatatgataatttcgttggtggtaatatgtgaaaaaattatgtaagcttagtcatggatcttaaccatggccatcctgaaa |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43185916 |
ggatttcaatcccgcttctgatatgataatttcgttggtggtaatatgtgaaaaaattatgtaagcttagtcatggatcttaaccatggccatcttgaaa |
43185817 |
T |
 |
| Q |
205 |
cccaggaattcaaatcgtatgcggtcaacaattttatgtgcattcacgcggtcagt |
260 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43185816 |
cccaagaattcaaatcgtatgcggtcaacaattttatgtgcattcacgcagtcagt |
43185761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University