View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17203_low_89 (Length: 270)
Name: NF17203_low_89
Description: NF17203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17203_low_89 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 75 - 265
Target Start/End: Complemental strand, 39983928 - 39983738
Alignment:
| Q |
75 |
cttcttaaatattggcaaattttggaatcttattgnnnnnnngcaagtcatagatttataaatcattgatgaatggctaatgtgagtgacaaattataaa |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39983928 |
cttcttaaatattggcaaattttggaatcttattgtttttttgcaagtcatagatttataaatcattgatgaatggctaatgtgagtgacaaattataaa |
39983829 |
T |
 |
| Q |
175 |
tcataactttatagattcttttgttgaatttctcctcgggatccaaatactagtgttatactaatgatgcagcaattgcttctctgctcct |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39983828 |
tcataactttatagattcttttgttgaatttctcctcgggatccaaatactagtgttatactaatgatgcagcaattgcttctttgctcct |
39983738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University