View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17203_low_99 (Length: 253)
Name: NF17203_low_99
Description: NF17203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17203_low_99 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 823784 - 823541
Alignment:
| Q |
1 |
tgcgatccggatttcctgacttcgtggcgccaaagtcaaggttttaaattccccaaacacgaggggggttatatgtatttgatttaagagaagtgctatt |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
823784 |
tgcgatctggatttcctgacttcgtggcgccaaagtcaaggttttaaattccccaaacacgaggggggttatatgtatttgatttaagagaagtgctatt |
823685 |
T |
 |
| Q |
101 |
ccccagcacaaaaaatgtctcgagcatttcacgaggcgtgtgcaccgttggatcttgattttaattccggtttaagtggaaaacatggtggtcatggtat |
200 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
823684 |
ccccggcacaaaaaatgtctcgagcatttcatgaggcgtgtgcaccgttggatcttggttttaattccggtttaagtggaaaacatggtggtcatggtat |
823585 |
T |
 |
| Q |
201 |
aacagccaatcacaac-aattcgctaccctttcttgagaataat |
243 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
823584 |
aacagccaaccacaacaaattcgctaccctttcttgagaataat |
823541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 108 - 157
Target Start/End: Complemental strand, 2287731 - 2287682
Alignment:
| Q |
108 |
acaaaaaatgtctcgagcatttcacgaggcgtgtgcaccgttggatcttg |
157 |
Q |
| |
|
|||||||||||| ||| |||||||||| || |||||||| |||||||||| |
|
|
| T |
2287731 |
acaaaaaatgtcccgatcatttcacgaagcttgtgcacccttggatcttg |
2287682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University