View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17205_high_18 (Length: 207)

Name: NF17205_high_18
Description: NF17205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17205_high_18
NF17205_high_18
[»] chr2 (1 HSPs)
chr2 (1-192)||(38264689-38264880)


Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 192
Target Start/End: Original strand, 38264689 - 38264880
Alignment:
1 tcgacaaccagacttctgtgctgcgatgtgagcaggatcgttggaatactttgtcgtggttaaaatcgtgattttccagtgggatcgtaggattgtgtgt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38264689 tcgacaaccagacttctgtgctgcgatgtgagcaggatcgttggaatactttgtcgtggttaaaatcgtgattttccagtgggatcgtaggattgtgtgt 38264788  T
101 gtggatagatgcaggtcaggttttggttatatgacatgtttggtttgcgccaatgactactgcactcgtgctgccatctgactctccctttt 192  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38264789 gtggatagatgcaggtcaggttttggttatatgacatgtttggtttgcgccaatgactactgcactcgtgctgccatctgactctccctttt 38264880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University