View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17205_low_10 (Length: 285)
Name: NF17205_low_10
Description: NF17205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17205_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 12 - 267
Target Start/End: Original strand, 5352503 - 5352760
Alignment:
| Q |
12 |
ccaagaatatacttggttcgaacataaagcattgagcaatgtgctataatctactcgacaacaaccatttatcaatctctttgaagattataaatctctc |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5352503 |
ccaacaatatacttggttcgaacataaagcattgagcaatgtgctataatctactcgacaacaaccatttatcaatctctttgaagattataaatctctc |
5352602 |
T |
 |
| Q |
112 |
tcaactcagttacatagttttttctctctcaaaggattagaaatggaatatggaannnnnnnctcacaatggtcaaggttgt--acaaattgatgtaggt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
5352603 |
tcaactcagttacatagttttttctctctcaaaggattagaaatggaatatggaatttttttctcacaatggtcaaggttgtacacaaattgatgtaggt |
5352702 |
T |
 |
| Q |
210 |
atcaaagtaaattttgaacttcacataccaaacttgtcaagttatgttaaaatatact |
267 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5352703 |
attaaagtaaattttgaacttcacataccaaacttgtcaagttatgttaaaatatact |
5352760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University