View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17205_low_14 (Length: 265)
Name: NF17205_low_14
Description: NF17205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17205_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 49 - 251
Target Start/End: Complemental strand, 31260004 - 31259802
Alignment:
| Q |
49 |
aaagaaggtactaagtagaactattaacaatgaagtatttatctttcatttttctatgatgaatgggagaagttaaatttacttctgaagaggtgtcctc |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
31260004 |
aaagaaggtactaagtagaactattaacaatgaagtatttatctatcatttttctatgatgaatgggagaagttaaatttacttcttaagaggtgtcctc |
31259905 |
T |
 |
| Q |
149 |
gtcataagtttgacaagatgcaaaagatgaaaatgtttgttattgatttgaaggatcgaacatgtatgctattgaatgcttcggtgggagacactagtaa |
248 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31259904 |
gtcatacgtttgacgagatgcaaaagatgaaaatgtttgttattgatttgaaggatcgaacatgtatgctattgaatgcttcggtgggagacactagtaa |
31259805 |
T |
 |
| Q |
249 |
gtg |
251 |
Q |
| |
|
||| |
|
|
| T |
31259804 |
gtg |
31259802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University