View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17209_high_51 (Length: 287)
Name: NF17209_high_51
Description: NF17209
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17209_high_51 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 18 - 277
Target Start/End: Original strand, 40501902 - 40502163
Alignment:
| Q |
18 |
acttccaatttgatggatgttgtgaatgctaacgaccaaagtgaaatactctcatagctgcaaaaata-tccacatgtgtcaatgaattttctcactggt |
116 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||| | |||||||||||| |||||||||||||| ||| |
|
|
| T |
40501902 |
acttccaatttgatggatgttgcgaaagctaacgaccaaagtgaaatactctcatagctgcaaaaaaaatccacatgtgtcgatgaattttctcaccggt |
40502001 |
T |
|
| Q |
117 |
aatgatttatggaggcagtacgaaacttctttaa-gaacgtacgttggaaactcattctagtgatcatctggtcgagaggtgagaactcagcaaagaaca |
215 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40502002 |
aaggatttatggaggcagtacgaaacttctttaaagaacgtacgttggaaactcatgctagtggtcatttggtcgagaggtgagaactcagcaaagaaca |
40502101 |
T |
|
| Q |
216 |
gaggtctctgggtcgtttcttgttgattctacaacacaatcgggtggaattcgatgcctttg |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
40502102 |
aaggtctctgggtcgtttcttgttgattctacaacacaatcgggtggcattcgatgtctttg |
40502163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University