View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17209_high_52 (Length: 276)
Name: NF17209_high_52
Description: NF17209
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17209_high_52 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 10 - 260
Target Start/End: Complemental strand, 3745221 - 3744971
Alignment:
| Q |
10 |
gaagaatatcaagaaaaagtgtgagaatggatttcaggttgatgggtttagatgctccagtgctacacgctttgcaccagatgatggatctttcagatga |
109 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| | ||||| |||||||| ||||||||||| |
|
|
| T |
3745221 |
gaagaaaatcaagaaaaagtgtgagaatggatttcaggttgatgggtttggatgctccagtgctacacgctcttcaccaaatgatggacctttcagatga |
3745122 |
T |
|
| Q |
110 |
caatgtggagaagacatcatcacacaatgctccaactagatcctatgttagagatgccaaggcaatggctgctactcctgcagatattaaggaagatcag |
209 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3745121 |
caatatggagaagacatcatcacacaatgctccaactagatcctatgttagagatgccaaggcaatggctgctactcctgcagatattaaggaagatcag |
3745022 |
T |
|
| Q |
210 |
aattcatacgtgttcgtgattgacatgccaggattgaaatctggggatatt |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3745021 |
aattcatacgtgttcgtgattgacatgccaggattgaaatctggggatatt |
3744971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 213 - 253
Target Start/End: Complemental strand, 48303219 - 48303179
Alignment:
| Q |
213 |
tcatacgtgttcgtgattgacatgccaggattgaaatctgg |
253 |
Q |
| |
|
||||||||||||||| | ||||||||||| ||||||||||| |
|
|
| T |
48303219 |
tcatacgtgttcgtggtggacatgccagggttgaaatctgg |
48303179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University