View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17209_high_57 (Length: 255)
Name: NF17209_high_57
Description: NF17209
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17209_high_57 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 76 - 238
Target Start/End: Complemental strand, 18631066 - 18630904
Alignment:
| Q |
76 |
ttgttaatgataaattttgttccttctcatctcttgttttagctggccttaacttatttgcaccagatacttcaaattttatggtgg-taggtatgagaa |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| ||| || |||||||||||| |
|
|
| T |
18631066 |
ttgttaatgataaattttgttccttctcatctcttgtttcagctggccttaacttatttgcaccagatacttcaatttttttgggggttaggtatgagaa |
18630967 |
T |
 |
| Q |
175 |
tgaattgcagggtctgatcagtaacaaataataggacagttatttcaattttttccttcatatt |
238 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18630966 |
tgaattgcagggtctgatcagtaac-aataataggacagttatttcaattttttccttcatatt |
18630904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 40 - 68
Target Start/End: Complemental strand, 18213142 - 18213114
Alignment:
| Q |
40 |
gcacagatacgaacacgaacaccagacac |
68 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
18213142 |
gcacagatacgaacacgaacaccagacac |
18213114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University