View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17209_high_68 (Length: 239)
Name: NF17209_high_68
Description: NF17209
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17209_high_68 |
 | |
|
| [»] scaffold0182 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-116; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 36969030 - 36969244
Alignment:
| Q |
1 |
ttgattctgttacgagtttcatttttcttgcatgtttctatttctgtagagaatccagaaatgagaaaacgacttcaaattttgtgttattgctttcgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36969030 |
ttgattctgttacgagtttcatttttcttgcatgtttctatttctgtagagaatccagaaatgagaaaacgacttcaaattttgtgttattgctttcgtt |
36969129 |
T |
|
| Q |
101 |
tatgtagtgtagattctatttttgatatcgattttctgtgtaacaaatgaactatatagtttagtgaagtaactgatttggtttggcgattgttcaaaat |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36969130 |
tatgtagtttagattctatttttgatatcgattttctgtgtaacaaatgaactatatagtttagtgaagtaactgatttggtttggcgattgttcaaaat |
36969229 |
T |
|
| Q |
201 |
ttattcacattatga |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
36969230 |
ttattcacattatga |
36969244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 23 - 91
Target Start/End: Original strand, 21723647 - 21723715
Alignment:
| Q |
23 |
ttttcttgcatgtttctatttctgtagagaatccagaaatgagaaaacgacttcaaattttgtgttatt |
91 |
Q |
| |
|
|||| |||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21723647 |
tttttttgcatgtttttacttctgtagagaatccagaaatgagaaaacgacttcaaattttgtgttatt |
21723715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0182 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: scaffold0182
Description:
Target: scaffold0182; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 23 - 91
Target Start/End: Original strand, 32283 - 32351
Alignment:
| Q |
23 |
ttttcttgcatgtttctatttctgtagagaatccagaaatgagaaaacgacttcaaattttgtgttatt |
91 |
Q |
| |
|
|||| |||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32283 |
tttttttgcatgtttttacttctgtagagaatccagaaatgagaaaacgacttcaaattttgtgttatt |
32351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University