View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17209_low_34 (Length: 375)
Name: NF17209_low_34
Description: NF17209
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17209_low_34 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 12 - 357
Target Start/End: Complemental strand, 40502505 - 40502159
Alignment:
| Q |
12 |
atgaacaagctccaatgaacgcgttaaactggccatcaccattcctcacaagactaccaatagcagcatcatttcccaagttgcaaacagcactatcaca |
111 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40502505 |
atgaacaagctccaatgaacgcattaaactggccatcaccattcctcacaagactaccaatagcagcatcatttcccaagttgcaaacagcactatcaca |
40502406 |
T |
|
| Q |
112 |
gtttgatttgatgtacaagattagatcattgtgagcaacaactctgagtaccacaacatcgtcgttgcacaagaagactctcagtgatcaccaaggtttg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40502405 |
gtttgatttgatgtacaagattagatcattgtgagcaacaactccgagtaccacaacatcgtcgttgcacaagaagactctcagtgatcaccaaggtttg |
40502306 |
T |
|
| Q |
212 |
atgaatgattattttggcaaatcatttgttgcccttccaacttattttgaaatttgaaagaccgtcttctttgttaaaagccaagaagtttaccctttcc |
311 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40502305 |
atgaatgaattttttggcaaatcatttgttgcccttccaacttattttgaaatttgaaagaccgtcttctttgttaaaagccaagaagtttaccctttcc |
40502206 |
T |
|
| Q |
312 |
agctaacactctaaaac-tccacatgccaactcgaataatcccaaag |
357 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
40502205 |
agctaacactctaaaacttccacatgccaactcaaataatcccaaag |
40502159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University