View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17209_low_41 (Length: 322)
Name: NF17209_low_41
Description: NF17209
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17209_low_41 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 10 - 264
Target Start/End: Complemental strand, 36292203 - 36291939
Alignment:
| Q |
10 |
attattcttgtatataagaacaacaaaaaatctcatattttttgttttaagtatatgcaaatataaactacttttgattcttttgttttcataaaacaag |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36292203 |
attattcttgtatataagaacaacaaaaaatctcatattttttgttttaagtatatgcaaatataaactacttttgattcttttgttttcataaaacaag |
36292104 |
T |
 |
| Q |
110 |
tttctacgaagagcattttagataatgcactannnnnnnatgagagatcaagaagattgactgtatttaactagnnnnnnnatgaaactaatttcttaat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
36292103 |
tttctacgaagagcattttagataatgcactatttttttatgagagatcaagaagattgattgtatttaactagtttttttatgaaactaatttcttaat |
36292004 |
T |
 |
| Q |
210 |
aagtgtgaaatttaa----------ttatttataatcaacaccgatagtattattttactaaact |
264 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36292003 |
aagtgtgaaatttaattatttatatttatttataatcaacaccgatagtattattttactaaact |
36291939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University