View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17209_low_68 (Length: 239)
Name: NF17209_low_68
Description: NF17209
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17209_low_68 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 21 - 239
Target Start/End: Original strand, 32086607 - 32086823
Alignment:
| Q |
21 |
ttagagtcaggatctttcttttgggtttcttgtttgctatctcctgtgcctcgcccaaactatttgcttcagtccacgtcctatcatatttcgatggttg |
120 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| ||||| |||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32086607 |
ttagactcaggatctttcttttgggtttcttgtttgctatctcctatgcctggcccaa-ctatttgcttcagtccacgtcctatcatatttcgatggttg |
32086705 |
T |
 |
| Q |
121 |
ctcttttggcctcctattcgctatttatcctgaaaaataaccttccagagttgtctctggaagccttttaaaacacagaatatcgttcaggagttatctc |
220 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| || |
|
|
| T |
32086706 |
ctcttttggcctcctattcgctctttatcctgaaaaataaccttccagagttgtctctggaagccttttaaaacacagaatatcgttcatgagttat-tc |
32086804 |
T |
 |
| Q |
221 |
atgaacaatttgcgcattt |
239 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
32086805 |
atgaacaatttgcgcattt |
32086823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 113 - 178
Target Start/End: Complemental strand, 36940326 - 36940261
Alignment:
| Q |
113 |
gatggttgctcttttggcctcctattcgctatttatcctgaaaaataaccttccagagttgtctct |
178 |
Q |
| |
|
|||| |||||||||||||| |||||| ||| |||||||||||||||||||||| |||||| ||||| |
|
|
| T |
36940326 |
gatgattgctcttttggccgcctatttgctctttatcctgaaaaataaccttcaagagttatctct |
36940261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University