View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17209_low_76 (Length: 221)
Name: NF17209_low_76
Description: NF17209
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17209_low_76 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 13 - 206
Target Start/End: Complemental strand, 8205477 - 8205284
Alignment:
| Q |
13 |
atcatcatcggagctgcggcaatgtgttgaggcaatcggggcaaagatgtcgaacgaggaggcggaaatggcggttgagcttctcgactcggacggtgat |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
8205477 |
atcatcatcggagctgcggcaatgtgttgaggcaatcggggcaaagatgtcaaacgaggaggcggaaatggcggttgagcttctcgactcggacggggat |
8205378 |
T |
 |
| Q |
113 |
gggttgattgggttggatgattttgtgaagtttgtagagggagggaaagaggaagagaaagtaaatgacctaagagaggcttttaagatgtatg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8205377 |
gggttgattgggttggatgattttgtgaagtttgtagagggagggaaagaggaagagaaagtaaatgacctaagagaggcttttaagatgtatg |
8205284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University