View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1720_high_104 (Length: 224)
Name: NF1720_high_104
Description: NF1720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1720_high_104 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 12 - 210
Target Start/End: Original strand, 11024078 - 11024276
Alignment:
| Q |
12 |
gatgaaggaagaaaagaaaggaatgttgattaaaggatgggttccacaagcgttaatattggatcatccatcgataggcggattcttaacgcattgtggc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11024078 |
gatgaaggaagaaaagaaaggaatgttgattaaaggatgggttccacaagcgttaatattggatcatccatcgataggcggattcttaacgcattgtggc |
11024177 |
T |
 |
| Q |
112 |
tggaacgcgaccgtggaagcaataagttccggagtaccaatggttacaatgcccggattcggggatcaatattacaacgagaaattggtgactgaggtg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11024178 |
tggaacgcgaccgtggaagcaataagttccggagtaccaatggttacaatgcccggattcggggatcaatattacaacgagaaattggtgactgaggtg |
11024276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University